The master regulator gene PRDM2 controls C2C12 myoblasts proliferation and Differentiation switch and PRDM4 and PRDM10 expression

Di Zazzo Erika^#, Bartollino Silvia*^# and Moncharmont Bruno

Department of Medicine and Health Sciences “V. Tiberio”, University of Molise, Italy

^#These authors contributed equally to this work

*Address for Correspondence: Silvia Bartollino, Department of Medicine and Health Sciences, “V. Tiberio”, University of Molise Via F. De Sanctis, 86100 Campobasso, Italy, Tel.: +39 0874404886, E-mail: silvia.bartollino@unimol.it

Dates: Submitted: 11 August 2017; Approved: 20 September 2017; Published: 25 September 2017

How to cite this article: Di Zazzo E, Bartollino S, Moncharmont B. The master regulator gene PRDM2 controls C2C12 myoblasts proliferation and Differentiation switch and PRDM4 and PRDM10 expression. Insights Biol Med. 2017; 1: 075-091. DOI: 10.29328/journal.ibm.1001007

Copyright License: © 2017 Di Zazzo E, et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Keywords: PRDM; RIZ; Cell cycle; Proliferation; Differentiation

The myogenesis of mammalian skeletal muscle cells is regulated by myogenic regulatory factors (MRFs), related in a hierarchical relationship [1], which are considered to be members of a superfamily of the highly conserved variant of the basic helix-loop-helix (bHLH) domain [2], that confers their peculiar myogenic potential [3]. The phylogenetic analysis of the sequences of these genes indicates that MRF genes have evolved from a single ancestral MRF gene progenitor, by gene duplication events followed by divergent mutations [4]. The four main basic helix-loop-helix myogenic regulatory factors, which exhibit a pivotal role in skeletal muscle development and which are responsible for coordinating muscle-specific gene expression in the developing embryo [5], are MyoD (Myf-3) [3], which coordinates an open chromatin structure at muscle-specific genes [1]; Myf-5 [6], which is required for the specification and proliferation of myoblasts [7-10], enhances myogenesis by promoting myoblast proliferation [11-13], because it is also the earliest to be expressed during myogenesis process, acting as a transcription factor in muscle progenitor cells (satellite cells) and myocytes [14]; Myogenin (Myf-1) [15], which is involved in the differentiation of myoblasts into multinucleated myotubes [16] and MRF4 [17], which is implicated in the latest phase of differentiation that includes myofiber maintenance [18]. The Myogenic regulatory factor (MRF) genes are expressed with a peculiar pattern [19,20] and they can auto- and cross-regulate the expression of each other and interact with the myocyte enhancer factor-2 (MEF2) family of transcription factors, to activate the transcription of muscle-specific genes [21]: currently, these MEF2 transcription factors are considered to drive the development of muscle, cardiac, skeletal, vascular, neural and blood cells, because of their pivotal effects on cell differentiation, proliferation, apoptosis, migration, shape and metabolism [22].

The activity of MRF proteins require heterodimerization with a member of the ubiquitously expressed E-protein family of bHLH proteins. This event leads the binding to the regulatory regions of muscle-specific genes on the E-box consensus sequence (CANNTG) [5]. Currently, only a small fraction of 14 million potential sites are available for MRF binding [23,24]. MyoD, the master regulator of the skeletal muscle gene expression program, activates genes which display the consensus E-box sequence VCASCTG (where V is A, C or G while S is C or G) within their promoter/enhancer regions [23,25-27] and it leads a gene expression program by heterodimerizations with E-proteins and giving rise to multinucleated myotubes [28]. The binding of MyoD on the E-box sequence (CANNTG) and the recruitment of factors, which are involved in remodelling the chromatin, are considered the crucial event for transcription [29,30] because MyoD activates pRb and p21 gene expression [31,32] to shoot down the cell cycle machinery [29]. The skeletal muscle differentiation is a strongly coupled event to the cell cycle exit [33] by an upregulation of cyclin-dependent kinase inhibitors (CDKIs), which inhibit cyclin-CDK complexes driving a downregulation of the activity of cyclin D1,E,A, and B-CDK complexes [34] and by an induction of the permanent cell cycle exit. This is a pivotal step because of the overexpression of cyclin/CDKs has been reported to inhibit the activity of MyoD by different mechanisms [29]. In particular, p21cip1/waf1, and p57/kip2, encoded respectively by Cdkn1a and Cdkn1c genes, control differentiation of skeletal muscle and their loss affects fiber formation: they have a key role both for cell cycle exit, both in triggering a muscle-specific transcriptional program [35]. The PRDM (Positive Regulatory Domain) gene family which consists of 17 orthologs in primates and 16 orthologs in rodents, birds and amphibians [36], encodes transcription factors with a PR domain and a variable number of zinc finger motifs [37], with the exception of PRDM11 [36,38]. The PR domain displays a 20-30% amino acid homology sequence to the catalytic SET (Suvar3-9, Enhancer-of-zeste, Trithorax) domain with hystone lysine methyltransferase (HMTs) activity [39]. In contrast to the SET domain proteins, currently only three PRDM proteins have been demonstrated to possess intrinsic HMTase activity [40] and a number of PRDMs have not endowed with catalytic activity towards histones/nucleosomes [41-44]. In particular the HMT’s activity has been found only in the PR domains of PRDM2/RIZ1, Prdm8 and Prdm9 [45-47]. In fact, the PR domain has diverged significantly from the SET domain [48-51] and most PR domains lack the H/RxxNHxC motif required for methyltransferase activity [52,53]. Generally, the PR domain is localized at the N-terminus of the protein, whereas the SET domain is often localized to the C-terminus [39]. A common characteristic of PRDM genes is the expression of molecular variants by alternative splicing or by alternative use of promoters. The PRDM1, PRDM2 and PRDM3, which is also called MECOM (MDS1-EVI1 complex locus) genes are expressed as two alternative forms, by intergenic splicing, which produce the PR plus and PR minus forms of these genes [54-57]. PR plus and PR minus forms are expressed at equimolar concentration and their ratio is maintained in a fine equilibrium [58]: an imbalance in the amounts of the two products, through either disruption or underexpression of the PR plus form or overexpression of the PR minus form commonly occurs in human cancers through genetic and epigenetic mechanisms [59-66]. PRDM2 gene gives two alternative products: RIZ1, the PR plus form, implicated in tumor suppressor function, and RIZ2, the PR minus form. This PR domain (PRDI-BF1 and RIZ homologous) [67] which is endowed with histone H3 K9 methyltransferase activity, is targeted by inactivating mutations in human cancers [68].

PRDM proteins mediate transcriptional activation or repression depending on the nature of their intrinsic HMT activity: PRDM proteins appear to function by modulating gene expression states either directly (via intrinsic HMTase activity), or indirectly (via recruitment of various cofactors), controlling critical aspects of cell integrity, spanning from cell differentiation to cell growth and apoptosis [58]. These genes also play a role in human cancer, where they mainly act as tumor suppressors: for example, PRDM1 is a tumor suppressor of diffuse large B cell lymphoma (DLBCL); PRDM3and PRDM16 show different isoforms with separate functions in leukemia [44,69]. PRDM16 (PRD1-BF1-RIZ1 homologous domain containing 16) controls a bidirectional cell fate switch between skeletal myoblasts and brown fat cells [70], the targeting of 3’UTR of Prdm16 is involved in the choise between myogenic and brown adipose determination of the adult skeletal muscle stem cells (satellite cells) [71], PRDM5 acts with a potential tumor suppressor role for gastrointestinal carcinogenesis [72-74].

The RIZ proteins regulate cell proliferation in a yin-yang manner [57,58,75]: gene silencing of the RIZ1 form, by genetic or epigenetic mechanisms, has been described in a variety of human tumors [14], whereas the RIZ2 form, lacking of PR domain, is always present or overexpressed [76]: this finding suggests a positive selection for RIZ2 in cancer progression. Further evidence indicates that forced expression of RIZ1 in tumor cell cultures induces growth arrest and apoptosis, possessing an anticancer activity in the PR domain [77], and the silencing of RIZ1 expression can stimulate breast cancer cell proliferation [78]. In addition, forced expression of the Zn-finger domain present in both RIZ forms increases the growth rate of breast cancer cells [79]. Based on these findings, RIZ1 could be considered as a crucial tumor suppressor gene candidate and the Zn-finger domain could be responsible for the putative oncogenic activity of the RIZ2 gene product. Such an effect might be more relevant in estrogen target tissues, where RIZ gene products are reported to directly interact with the estrogen receptor in a hormone-dependent manner through a LXXLL motif [80,81], promoting optimal estrogen response; conversely, in osteosarcoma cancer cell line (SAOS2), RIZ1 is expressed at high level in proliferating cell compared to serum-free culture conditions [82]. Murine models studies demonstrated that PRDM1 regulates commitment, as well PRDM14, PRDM9 is involved in meiosis [83], PRDM16 is involved in the switch controlling of myoblast differentiation to brown adipocytes [70,84]; PRDM3 and PRDM16 are also required for the maintenance of brown adipocyte identity [85], but currently the PRDM2 role in the development and in myoblast differentiation is still unclear. The purpose of this study therefore was to investigate the expression profile and the role of PRDM genes in the molecular mechanism responsible of the proliferation-differentiation switch, paying particular focus on the PRDM2 gene expression in skeletal muscle C2C12 cell line, an established cell model for skeletal muscle differentiation studies [86,87], that has been successfully used to study differentiation and proliferation-differentiation switch [88].

Cell culture and transfection

C2C12 cells (kindly provided by Professor Fabio Naro from University “La Sapienza”-Rome) were maintained in DMEM (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum, FBS (Invitrogen), referred as GM, i.e. growth medium, in humidified 95% air and 5% CO2. As the cells reached confluence, the medium was replaced with DMEM supplemented with 10 μg/ml insulin (Invitrogen). And 5 μg/ml transferrin (Invitrogen) referred as DM, i.e. differentiation medium, to induce differentiation of myoblasts into myotubes. Cell transfection with plasmid DNA was performed using Lipofectamine® 2000 Reagent (GIBCO BRL, Life Technologies, Rockville, MD, USA) in OptiMem I Reduced Serum Medium (Invitrogen) for 6 hours, according to the manufacturer’s instructions. Transfection medium was then removed, and cells were grown in DMEM supplemented with 5% FBS or DM, as indicated in the legend to figures, for additional 24-48-72 hours. Reverse transcriptase-polymerase chain reaction (RT-PCR)-Total RNA (1 µg) was extracted from C2C12 cells using Trizol reagent (Invitrogen), according to the manufacturer’s instructions. Gel electrophoresis in denaturing conditions was performed to evaluate the integrity of extracted RNA; the quality of RNA extracted was evaluated by the measure of 260/280 nm and 260/230 nm absorbance ratios (the threshold acceptance was 1.9 for absorbance ratio 260/280 nm and 2.2 for absorbance ratio 260/230). To remove contaminant DNA, RNA samples were treated with 40 U of RNase-free DNase-I (Boehringer Mannheim, Indianapolis, IN, USA) for 45 minutes at 37°C. The absence of contaminant genomic/plasmid DNA was checked by PCR of not reverse transcribed RNA samples. Total RNA was reverse transcribed using cDNA Synthesis Kit Transcriptor High Fidelity (Roche, Basilea, Switzerland). The cDNAs amplifications were performed by RT-PCR with specific primers set for glyceraldehyde-3-phosphate dehydrogenase (GAPDH)s, for MRF and for the detection of the PRDM plus transcript (PRDM PR as reported in table 1) and also for all PRDM transcripts (PRDM TOT as reported in table 1) using JF buffer (30mM Tris base, 8mM HEPES base, 20mM K glutamate, 60mM NH4 acetate, 2mM DTT, 8% glycerol, 1.5mM MgCl2, 0.2mM dNTPs) [79]. The reaction was performed using a thermal cycler (Eppendorf, Milan, Italy). Analysis of amplified products was done by electrophoresis on 2% agarose gel. The gel images were acquired by the Gel DOC XR System platform (Bio-Rad laboratories, Hercules, CA).

Quantitative Reverse-Transcription PCR (qRT-PCR) Analysis-Aliquots of cDNA were subjected to quantitative analysis by real-time PCR (qRT-PCR) using the SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) in a Mastercycler ep Realplex (Eppendorf), as previously described [89]. The amplification was performed using the same primer sets of semi-quantitative RT-PCR. GAPDH was used as housekeeping gene for normalization. The dissociation curves showed a single peak and the agarose gel analysis of PCR amplicons showed a single DNA band of the expected molecular size. The relative quantification (RQ) was performed using the Δ-ΔCt method [90]. Data were presented as RQ (Relative Quantification) by comparing the threshold cycle of PCR products to the threshold cycle of standard cDNA. The linearity and the efficiency of the PCR reaction were analyzed by serial cDNA dilutions. Each amplification was done in triplicate and the reaction specificity was assessed by melting curves analysis. PRDM2 PR silencing by RNA interference -The gene silencing of PRDM2 PR gene product was achieved using the BLOCK-iT™ Pol II miR RNAi with emGFP expression vector (Invitrogen), according to the manufacturer’s instructions. The oligonucleotides, Hmi418948 and Hmi418951, which target PRDM2 PR gene product (Invitrogen Co.), were cloned into the vector (pcDNA™ 6.2-GW/EmGFP-miR). C2C12 cells were transfected with recombinant vector or with kit control vector (β-galactosidase, CTRL). Protein assay -The protein concentration was measured with BIO-RAD Protein Assay (Bio-Rad Laboratories, Hercules, CA) according to the manufacturer’s instructions.

Western blot analysis- C2C12 cells were washed with PBS and lysed in RIPA buffer 1X [50 mM Tris HCl pH 7.5, 150 mM NaCl, 0.25 % sodium deoxycholate, 1% NP-40 supplemented with protease inhibitor cocktail (Roche, Basilea, Svizzera). The clarified lysates were processed for Sodium Dodecyl Sulphate - PolyAcrylamide Gel Electrophoresis, SDS- PAGE (10% polyacrylamide gel) according to Laemmli procedure [91]; subsequently the proteins were transferred to PVDF membrane (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) using transfer buffer. Blots were blocked with 20 mM Tris pH 7.8, 100 mM NaCl, 0.1% Nonidet P40/Tween 20(1:1), 5% non-fat milk and incubated with primary antibodies diluted in the same buffer (0.1ml/cm2). The following antibodies were used at the indicated concentrations: mouse monoclonal anti-MyoD: sc-32758 (Santa Cruz Biotechnology) at the following concentration 0.2μg/ml; mouse monoclonal anti- Myc: sc-40 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) at the following dilution 1:500; mouse monoclonal anti-Myogenin: sc12732 (Santa Cruz Biotechnology, Inc.,Santa Cruz,CA) at the following dilution 1:500; rabbit polyclonal antibodies to RIZ1, RIZ 9710 (Abcam Ltd., Cambridge, UK) at the following dilution 1:1000, rabbit polyclonal antibodies against PRDM4 and PRDM10 (EPIGENTEK) at the following dilution 1:1000. Thereafter the same filter was stripped and reprobed with mouse monoclonal antibody against Histone H1 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) at the following dilution 1:1000. Peroxidase-conjugated anti-rabbit IgG or anti-mouse IgG secondary antibodies were used at 1:5000 dilution. Peroxidase activity was detected using an Amersham ECLTM Advance Western Blotting Detection Kit (GE Healthcare, Little Chalfold, UK), according to the manufacturer’s instructions. Membranes were exposed with Amersham Hyperfilm ECL film (GE Healthcare, Little Chalfold, UK) and images were acquired with the Gel DOC XR Platform (Bio-Rad Laboratories, Hercules, CA).

Cell growth analysis- Cell proliferation was evaluated by cell counting, by MTT (3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay (Sigma-Aldrich, Co. St. Louis, MO, USA) and by FACS (Fluorescence Adsorbed Cell Sorting, Becton Dickinson, New Jersey, USA) analysis as previously indicated [58].

Immunofluorescence analysis

Myoblasts were plated on poly-L-lysine (3x)-coated coverslip and cultured in DM for 72h. Subsequently DM was discarded and cells washed three times with PBS and incubated at room temperature with freshly-made paraformaldehyde (4% w/v) for 10 min. The cells were washed with glycine 0.1% for 5 min, followed by three washing in PBS, subsequently incubated for 2 hours with the following primary antibodies: (a) mouse monoclonal anti-MyHC (Sigma-Aldrich, Co. St.Louis, MO,USA) at the following dilution 1:500; (b) RIZ 9710 (Abcam Ltd, Cambridge, UK) at the following dilution 1:100. The primary antibodies were diluted in PBS containing 10% (v/v) fetal bovine serum (FBS) and 0.1% Triton X-100. Cells were then washed in PBS and incubated at room temperature for 1 h with fluorescent secondary antibodies (Jackson Laboratories, USA): (a) anti-mouse or anti-rabbit IgG conjugated to Texas red were diluted 1:100 in PBS containing 10%(v/v) fetal bovine serum (FBS) and 0.1% Triton X-100. Subsequently, coverslips were placed onto untreated glass slides and allowed to air dry. Coverslips were analyzed using a Zeiss LSM 510 Meta argon/krypton laser scanning confocal microscope. Each image was acquired 4 times and the signal averaged to improve the signal to noise ratio. Computer-assisted quantitative evaluation of channel distribution in cell compartment was done using the Image-J software.

Chromatin immunoprecipitation (ChIP)

C2C12 cells (approximately 5x106 cells/plate) were cultured in GM or in DM for 24, 48 and 72 hours. One-tenth aliquots were immunoprecipitated using the following antibodies: 1µg of purified IgG control antibody (Sigma-Aldrich), 1mg of rabbit polyclonal anti-RIZ1 (Abcam Ltd, Cambridge, UK) or 1 µg of mouse monoclonal anti-MyoD (Santa Cruz Biotechnology Inc., Santa Cruz, CA). Secondary immunoprecipitation was performed with Sepharose coupled to protein A (Sigma-Aldrich, Co. St. Louis, MO, USA). One-twenty-fifth of the DNA extracted from each immunoprecipitation was amplified using primers complementary to the Myogenin promoter region E2_E1 Forward-GAATCACATGTAATCCACTGGA E2_E1 Reverse- ACGCCAACTGCTGGGTGCCA). Amplifications were performed for an empirically determined number of PCR cycles producing a linear correlation between amplified band signals and template dilutions. AmpliTaq polymerase in AB1 buffer (30mM Tris base, 10mM HEPES base, 25mM KCl, 20mM K glutamate, 20mM NH4 acetate, 1.25mM DTT, 5% glycerol, 1.25mM MgCl2, 0.2mM dNTP) (Applied Biosystems, Foster City, CA) was used for all PCR analyses. Amplification products were analyzed by 2% agarose gel electrophoresis and bands were visualized with the Gel DOC XR System (Bio-Rad laboratories, Hercules, CA); densitometric analysis was performed using Total Lab 1D software. Statistical analysis-Statistical significance was determined with a paired t-test with Graphpad prism 5.0 software (La Jolla, CA, USA).

Analysis of the expression levels of MRF genes and PRDM genes in myoblasts and myotubes

To induce differentiation of myoblasts into myotubes, confluent C2C12 cells were incubated in low mitogenic media (DM) and after 72 hours, differentiation is complete as observed by morphological changes. To verify the fidelity of the model used, an immunofluorescence analysis (Figure 1S a) of C2C12 cells differentiated in the same experiment was performed. The results revealed that after 72 h in DM medium cells formed myotubes expressing the myosin heavy chain (MyHC), a marker of myoblasts differentiation (Figure 1S b-c) [92]. The expression level of PRDM genes (PRDM1, 2, 4, 5, 10, 14 and 16) and MRF genes: Myc and Myogenin was evaluated by qRT-PCR analysis. The amplification of PR plus product was performed with a set of primer amplifying a transcript region encoding for the PR domain (PRDM PR F/R) and another primer set was used for amplification of a region common to both PR plus and PR minus forms (PRDMtot F/R). As expected, the low mitogenic environment increased the expression level of differentiation markers Myogenin and reduced the proliferation markers c-Myc (Figure 1). In our experimental conditions, myotubes showed no significant variation in the PRDM1, PRDM5, PRDM14 and PRDM16 expression level than myoblasts. On the other hand, PRDM2, PRDM4 and PRDM10 expression levels falls down into myotubes than myoblasts. So we decided to further investigate the variation in the expression level of PRDM genes that showed a significantly difference in the expression level between myoblasts and myotubes.

Analysis of the expression levels of MRF genes and PRDM genes during differentiation of myoblasts in myotubes

To induce differentiation of myoblasts into myocytes, confluent C2C12 cells were incubated in low mitogenic media (DM) and at different time (0, 24, 48, 72 hours) was evaluated by qRT-PCR the expression level of MRF genes: Myc, Myf5, MyoD and Myogenin. As expected, the low mitogenic environment increased quickly the expression of differentiation markers MyoD and Myogenin and reduced the proliferation markers Myc and Myf5 expression level (Figure 2). It has been extensively demonstrated by Cheedipudi et al. [87], that PRDM2 gene expression levels is lower in myotubes than myocytes but no evidence are available on the variation of other member of PRDM family gene expression level during differentiation induction. In order to determine the precise temporal gap in which occurred PRDM expression level variation, qRT-PCR analysis of total C2C12 RNA extracted at different time (24, 48 and 72 hours) from differentiation induction was performed. As shown in figure 3A and B, at 24 h from differentiation induction PRDM2, PRDM4 and PRDM10 genes were expressed at lower level then myoblasts. This reduction was more evident at 72 h for PRDM2 PR plus product. Interestingly and according to Cheedipudi [87], the maximal expression of Myogenin at 72 h from differentiation induction corresponds to the reduction of band intensity of PRDM2 PR. The particular behaviour of PRDM2 gene prompted us to investigate the relationship between PRDM2 gene and myoblasts differentiation. Immunofluorescence analysis (Figure 2S) of C2C12 in GM or after culture in DM for 24 h revealed that RIZ1 in proliferating condition is predominantly localized in the nucleus and translocates into the cytoplasm when C2C12 cells are committed to differentiate.

Effect of PRDM2 silencing on C2C12 myoblasts differentiation

As observed by qRT-PCR analysis of PRDM2/RIZ1 (60%) forced suppression with the plasmid coding the miRNAPRDM2 spanning a sequence coding for the aa 97-103 of RIZ1 protein, induced an increase in expression level of the differentiation markers MyoD and Myogenin that was more evident for the last one (Figure 4). This evidence confirms that RIZ1 protein negatively controls the induction of differentiation mediated by MRF factor. Western blot analysis of whole cell lysates from C2C12 transiently transfected with a control plasmid or with the plasmid coding the miRNAPRDM2, showed a strong reduction in the RIZ1 expression level, revealing the efficacy of the interference (Figure 5). The PRDM2/RIZ1 silencing induced a decrease in the PRDM4 and PRDM10 expression levels. These evidence support the hypothesis that different genes of PRDM family control proliferation/differentiation switch and are probably organized in a hierarchical manner.

Interaction of RIZ with E2/E1 Myogenin promoter region

ChIP experiments were performed to detect the presence of MyoD, a master regulator of the skeletal muscle gene expression program [28], and RIZ on E2/E1 Myogenin promoter region during differentiation induction. Therefore, equivalent amounts of cross-linked chromatin from myoblasts cultured in GM or DM (24, 48 and 72 hours) were immunoprecipitated in parallel with two antibodies that recognize PRDM2/RIZ1 or MyoD. The precipitated DNA then was subjected to PCR amplification with the use of a primers set, spanning two of the E-box sites (E1 and E2) located in the proximal region of Myogenin promoter. Results shown in Fig. 6B, revealed that MyoD was ever associated with Myogenin promoter according to Mal et al., [93]; conversely, as shown in figure 6A, RIZ1 was associated with the E2/E1 Myogenin promoter region in myoblasts at 24h whereas at 48h and 72h no association of RIZ1 was detected. The specificity of this assay is demonstrated by the observation that the binding of MyoD or RIZ1 was not observed when a normal rabbit IgG was used in the analysis.

RIZ1 silencing induced cell cycle arrest

In order to investigate the effect of RIZ silencing on proliferation rate, we performed a cell cycle analysis evaluating propidium iodide incorporation by FACS. As shown in figure RIZ1 silencing by miRNA induced a G1 phase delay. Likewise MTT assays of C2C12 cells transfected with the miRNAPRDM2 plasmid significantly reduced the cells number (Figure 7).

PRDM family gene plays a key role in the control of a plethora of cell life processes, like cell cycle progression, homeostasis maintenance of immune system and control of early stage of development. PRDM1 and PRDM14 for example guide the epigenetic reprogramming, necessary to determinate the progenitors of germ cells during embryonic development; PRDM9 also is indispensable for meiotic prophase progression during gametogenesis; PRDM16 controls the cell fate switch between myoblasts and brown adipocytes: recently studies, conducted by Li et colleagues, demonstrated that C2C12 myoblasts, stably transfected with PRDM16, showed a repression of myogenic genes and an upregulation of adipogenic genes at proliferation and differentiation genes, probably due to CpG methylation of MyoD [84]. To this behaviour, the study of molecular basis of PRDM action mechanism appears very important. Data obtained by RT-PCR and Western blot analysis in C2C12 cell line showed that the expression of PRDM2 gene was selectively modulated during differentiation, because of the differentiated cells showed reduced levels of expression of RIZ1 than myoblasts. This trend is in disagreement with the experimental evidence obtained in epithelial cell line models [78] and lymphocytes [94] in which treatment with differentiating agents, or the stimulation of cell proliferation, respectively, caused the increase and decreased of PRDM2/RIZ1 expression. On the contrary, there are some similarities with the experimental evidence obtained with the osteosarcoma cell line (SAOS2), in which PRDM2/RIZ1 showed an elevated expression in proliferating cells, compared to cells that had temporarily left the cell cycle [95]. These suggestions left us to speculate that RIZ can be related to the cell type and in the mesenchymal cells perhaps cell cycle escape and subsequent differentiation coincide with RIZ1 expression level reduction: immunocytochemistry experiments, performed in myoblasts and myotubes, showed that during differentiation there is an intracellular redistribution of RIZ protein, predominantly localized in the perinuclear and nuclear area. This phenomenon, as myeloid leukemia cell line HL60, could be interpreted as an intranuclear confinement of RIZ protein. Expression level analysis by qRT-PCR of other member of PRDM family gene PRDM4 and PRDM10 showed that the differentiation induction was characterized by a reduction of its expression levels. In order to confirm the involvement of PRDM2 gene in the proliferation-differentiation switch, we performed knockdown experiments. Interestingly, the PRDM2 gene silencing was characterized by a Myogenin expression level increasing, suggesting its peculiar role in the transcriptional control of myogenin expression. ChIP experiments performed with MyoD and RIZ antibodies on E2/E1 Myogenin promoter region in proliferation condition and after 24 h from differentation induction, confirmed a binding on the Myogenin promoter. As demonstrated by Mal A. [93], Lys-9 of H3 histones were methylated by SUV39H1 [96], surrounding the myogenin promoter in undifferentiated myoblasts. This marking was dramatically reduced in myoblasts that had undergone differentiation. We hypothesize that another member of SET family protein, RIZ1, can modulate myogenin expression, and RIZ1 interference reduced the expression level of PRDM4 and PRDM10 genes, lead us to speculate that the members of the family have a redundant PRDM behavior and/or cooperate in the transition proliferation-differentiation. Futhermore PRDM2 silencing induced a G1 phase delay and a reduction of proliferation.

In conclusion, our studies suggest that PRDM2, PRDM4 and PRDM10 play a pivotal role in the proliferation-differentiation switch of myoblast in myotubes.

This work was supported by grants from the Italian Ministry of University and Scientific Research PRIN.